Analogy/Homology

1. 

a. The two species that I identified as having a homologous trait were humans and Felis Catus (common house cat). The domestic cat is a small, typically furry, carnivorous mammal. Humans are also mammals that are characterized by erect posture, movement on two feet, manual dexterity, increased tool usage compared to other mammals and a general trend towards larger, more complex brains and societies.  

b. The homologous trait that they share is between the tailbone in humans and the tail of the cat. In humans, the tailbone has become a vestigial structure. The coccyx, also known as the tailbone, is a "small, triangular bone resembling a shortened tail located at the bottom of the spine. It is composed of three to five coccygeal vertebrae or spinal bones. The vertebrae may be fused together to form a single bone; however, in some cases, the first vertebra is separate from the others" (Healthline). The tailbone functions as "an attachment site for tendons, ligaments, and muscles. It also functions as an insertion point of some of the muscles of the pelvic floor. The coccyx also functions to support and stabilize a person while he or she is in a sitting position" (Healthline). In domestic cats, the tail plays a much different role. The purpose of their tails is primarily for balance, marking their territory, and communication (Factual facts). The cat’s tail has "19 to 23 vertebrae, about 10 percent of the total number of bones in her body. An extensive group of muscles, ligaments, and tendons hold the tail together and provide its amazing mobility" (Catster). These homologous traits that the human and Felis Catus possess because of how each of the two species use them. The domestic cat uses its tail for a variety of reasons, many of which are for balance and communication, and the human only uses its tailbone for stabilization when in certain positions and support for the pelvic floor.

c. The common ancestor of humans and domestic cats is the first mammal to exist. All mammals possess this same homologous trait for a tail. Humans express this trait as a vestigial one as it is not used as a traditional tail like a domestic cat would.

d.

2.

a. The two species that I identified as having an analogous trait were dolphins and sharks. Dolphins are "highly intelligent marine mammals...(that are)...found worldwide, mostly in shallow seas of the continental shelves, and are carnivores, mostly eating fish and squid" (Defenders). Sharks belong to a family of fish that have skeletons made of cartilage, breathe through a series of five to seven gill slits located on either side of their bodies and have multiple rows of teeth. (Defenders).

b. The analogous trait that the dolphin and shark share is their dorsal fins. In dolphins, the dorsal fin, located on the top of the animal, is "filled with a fibrous  connective tissue. It serves to keep the animal upright and prevents "roll". Also, it has a thermo-regulation (body temperature adjustment) function" (Understand dolphins). Shark's dorsal fins do much of the same things for the animal. The only difference is that sharks have a pair of dorsal fins instead of just one. The first dorsal fin is "located on the top of a shark’s back and is used to stabilize the shark in the water. Lined with strong, flexible dorsal fibers, the first dorsal fin keeps a shark from rolling on it’s back and helps it make sharp turns while swimming fast" (Shark insider). The secondary dorsal fin "helps to stabilize the shark in the water. The second dorsal fin helps the shark swim steadily and maneuver the back of it’s body more easily" (Shark insider).

c. If you go far enough back in time, you will find a common ancestor of the shark and the dolphin. But, sharks are classified as fish and dolphins are classified as mammals. So, even though they both possess the same trait of having a dorsal fin that provides very similar functions for them, it is still an analogous trait. This is because it is not a result of common genetic history. It is, however, a result of common environmental pressure that caused both species to develop a similar adaptation to that stress.

d.

http://www.healthline.com/human-body-maps/coccyx

https://factualfacts.com/animals/cats-tails/

http://www.catster.com/lifestyle/cat-tail-5-cool-facts

http://www.defenders.org/dolphin/basic-facts

http://www.defenders.org/sharks/basic-facts

http://understanddolphins.tripod.com/dolphinfinstructurefunction.html

http://www.sharksider.com/understanding-shark-fins/

DNA code

ACATTACAAAACCGTTCAAGTGAGCACCCGTTGATGGATCGTAC

Thomas Malthus: The individual who's work and contributions most influenced Darwin's theory of natural selection

In the time period that Charles Darwin was completing the research that was necessary to support his theory of natural selection, the concept of species evolving to be better adapted for their environment was not a new concept. Several people, books, ideas and data that were available at the time strongly shaped his work, leading him to the conclusion that the origin of species existence and continued survival was directly related to the product of competition and natural selection.

After researching the many people who influenced Charles Darwin's life, work, and way of thinking, I now see that the most influential of the group was Thomas Malthus. In his book titled "An Essay on the Principle of Population," Malthus argued that "human populations grow faster than the resources that they depend on" (CK-12). Malthus recognized this as a problem because with the population of humans growing exponentially, and the amount of resources that humans need being produced only arithmetically, humans would soon run out of them completely, and perish as a result (CGGE). Malthusian economics laid the groundwork for Darwin's theory of natural selection. Limited resources force competition within a species and only those most fitted for survival would prosper.

From the bullet points listed under "How does evolution work," Malthus' work directly affected all of the first five. The first one, that highlights the Malthusian idea of exponential reproduction of humans, was indeed the starting point of Darwin's work as the bullet point information points out. The next two on the list, each having to do with the limitation of resources aim to answer the question posed at the bottom of the first bullet point; why is it that if species can reproduce exponentially, we are not witnessing them becoming dangerously overpopulated as Malthus predicted in humans? Darwin took the Malthusian idea that species reproduced exponentially and built on it to conclude that even though resources were limited, this limitation caused competition within the species and in turn created natural selection as an avenue to population control. In the next two bullet points which have to do with the idea that only the fittest will survive, it becomes extremely apparent that Darwin built off of Malthus' ideas. Organisms with better access to resources will be more likely to survive, and the ones that have the better access are able to do so because they are the most fit for survival. Using the Malthusian idea that if species could reproduce exponentially, Darwin reasoned that the only way the resources would not run out is if there was some sort of population control; natural selection caused only the fittest organisms to have access to the resources. Darwin's ideas did not contradict Malthus'. His ideas built on them and took them farther than Malthus ever did.

When examining the effects of Malthus' ideas on Darwin and trying to answer the question of if Darwin would have been able to come up with his theory of natural selection without him requires a few different things to be considered. The first of these is the fact that Malthus' book, "An Essay on the Principle of Population," inspired him and sparked his interest (All About...). Without Malthus' groundwork, Darwin possibly could have made a connection between the scarcity of resources and natural selection in species, but it is also possible that he couldn't. Another important thing to consider is that the ideas Darwin was proposing were both revolutionary and controversial in the eyes of the church and common man. Going against a theistic explanation for the natural occurrences he was witnessing and instead turning to science and observation of fact would have been seen as wrong. Without the groundwork that Malthus laid for Darwin, it is possible that he would have been discouraged from pursuing the idea any farther.

After Darwin published "On the Origin of Species," he received a great deal of backlash from various different directions. One of the most influential of these on him, both before he published his work and after, was the church. Before he published it, he "fully understood, and at times agonized over, the threat that his work might pose to traditional religious belief " (Masci). Darwin's theory on natural selection was no doubt in direct opposition to the views of the church, but he could see the writing on the wall in the form of observations that he had made in the real world. The attitude of the church made Darwin hesitant to publish his theory, however, he could see that the theistic explanation for the natural occurrences he was witnessing was not correct.

- Steven Moentmann 

http://www.ck12.org/book/CK-12-Biology-Concepts/section/5.13/

http://cgge.aag.org/PopulationandNaturalResources1e/CF_PopNatRes_Jan10/CF_PopNatRes_Jan108.html

http://www.allaboutscience.org/thomas-malthus-faq.htm

http://www.pewforum.org/2009/02/04/darwin-and-his-theory-of-evolution/