Human Variation and Race

Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress negatively impacts the survival of humans by disturbing homeostasis. 

One environmental stress which negatively impacts the survival of humans by disturbing homeostasis is high levels of solar radiation. UV radiation is part of the electromagnetic spectrum that reaches the earth from the sun, with wavelengths that are invisible to the naked eye due to being shorter than visible light. These wavelengths are classified as UVA, UVB, and UVC. UVA radiation, which is the longest of the three wavelengths, is able to get through earth's natural ozone layer and affect humans by penetrating the epidermis and dermis layers of skin. UVB radiation is also able to get through the ozone layer, but only penetrates the epidermis layer of skin. UVC radiation usually is absorbed by the ozone layer, and has little effect on our skin. When we are overexposed to UVA and UVB radiation from being out in the sun for too long the result can be a suppression of the immune system. UVB rays are the more damaging of the two, and can potentially cause genetic damage that may lead to skin cancer due to it being directly absorbed by the DNA within cells. This damage that happens at the genetic level disturbs homeostasis, and can threaten the life of the human species. However, there is one benefit from the exposure to UV radiation that we get from being in the sun. This benefit is our bodies ability to stimulate vitamin D production caused by the UVB waves.

Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural). Include images of the adaptations. 

Short term:

Unfortunately, humans have no short term adaptation to solar radiation. It is for this reason that solar radiation is an extremely dangerous thing for humans to be exposed to for extended periods without natural or artificial forms of protection.

Facultative:

One facultative adaptation that protects humans from harmful forms of UV radiation is tanning. When human skin is exposed to sunlight, a protective mechanism is triggered and the epidermis layer increases the amount of melanin that it produces. This increased production of melanin causes the skin to turn to a darker shade than it was prior to exposure, and this effect will remain until the exposure to the UV rays is reduced. One way that this is seen in humans is when during the summer months of the year, people spend more time outdoors in clothing that leaves their skin uncovered due to the hot temperatures. As a result, their skin will tan; assuming that they are genetically able to. Then, when the weather turns colder during the winter months, their skin will lose its tan complexion and return back to its normal shade as they spend less time outdoors and choose to wear more clothing.

Developmental:

Developmental adaptations to high levels of solar radiation are found in populations with high concentrations of people with dark skin tone. The darker a human's skin is, the higher the concentration of melanin that it produces. Populations that are exposed to the sun's harmful rays the most are located in arid, desert locations like Africa and some other tropical climates. This developmental trait is something that humans are born with, and it will not be changed over ones lifetime.






Cultural:

To make up for the fact that humans have no short term adaptations to high levels of solar radiation, we have come up with many cultural adaptations that we use regularly. Some of these include clothing, shelter, and sunblock. The use of clothing and shelter reduced our ancestors need to produce so much melanin. Also, migrating to areas that were more shaded such as forests allowed them to reduce the time that they spent under the stress of the suns UV radiation. This is why we can see a definite change in skin pigmentation between humans who occupy the northern regions and humans who occupy the southern regions near the equator. In modern times, the invention of sunscreen made it possible for people of all skin types to safely spend time in the sun without the use of clothing or shelter. Although, exposure to the sun's UV rays is still dangerous. Even with the use of sunscreen, which just limits the amount of UV radiation that your skin can absorb.  
















What are the benefits of studying human variation from this perspective across environmental clines? Can information from explorations like this be useful to help us in any way? Offer one example of how this information can be used in a productive way. 

The benefit of studying human variation in this way is that by studying the changes in various populations over a period of time, we can identify the environmental stresses that act on them. Information from explorations like this can most definitely help us. For example, if we study rickets, which is found in populations of lighter skinned people, we can further understand the importance of our need for sunlight and vitamin D.

How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race. 

Personally, I would use race in a way that makes it possible for us to see how our ancestors developed over time. To accomplish this, I would use race only to classify groups of people who inhabit the same geographical area that show the same adaptations to their environment. By doing this, it would also give us the benefit of understanding what changes will occur in a population of people who are exposed to the same environmental stresses.

In opposition to the use of race, studying environmental influences on adaptations is a better way to understand human variation because it gets people to see the ways that we as humans are alike, instead of the ways that we are not. I feel that this is a big factor in getting people to abandon racist ways of thinking. Studying the human species in this way can help us to understand that the differences we have between one another are simply responses to our environments; which are also very different. Our ability as humans to adapt and change to be better suited for our environments is something that connects us at a genetic level, and has nothing to do with being superior or inferior to one another.

Language

   For the first part of the language experiment that we were asked to preform in week six, I asked for the help of my girlfriend and her mother. After explaining to them the object of the experiment, I began to think of a starting point for our conversation. This turned out to be more difficult than I thought; not being able to use words to communicate proved to be quite difficult, but I eventually came up with something. To communicate with my girlfriend and her mother, I used different methods such as signaling with my hands, head movements, facial expressions, and non-verbal vocalizations such as grunts. To me, the most successful of these methods were the head movements and hand movements. Although, the non-verbal vocalizations came in handy as well for simple answers to their questions. I felt that the tone of my vocalizations really helped a lot in aiding the communication between us. When it comes to the changes that they made in order to bridge the gap in communication between us, I felt that the most helpful things that they did were asking a lot of simple questions that would require a yes or no answer (if I could use words) and incorporating some hand signals and head movements of their own. To me, it was cool to see this happen and I was able to compare it to the time that I have spent in Spanish-speaking countries. Recently I went to Santiago, Chile, which is in South America. In some of the rural areas outside of the city, there are not many people that speak English. For me, this was quite difficult as my abilities in speaking the Spanish language are not fully developed. But as I found out, communication between two individuals that speak different languages is eased when each know at least some of each others language. When speaking to someone, I would try my best at Spanish, substituting words that I didn't know with English words. They would do the same, except with the English words they didn't know, they would use Spanish. This concept is exactly what happened between my girlfriend, her mother and myself. They used some of my "language" and (excluding verbal vocalization) I tried my best to match my methods of communication with theirs. This eased the communication between us.

   In terms of who had the power in controlling the conversation, I think that each side had relatively equal amounts, but it was slanted in favor of my girlfriend and her mother. I feel that they were more in control of the conversation due to their ability to use words. In any interaction between two people or two groups of people, I would say that the power lies with whoever is able to ask the questions, and change the topic of the conversation.There is no doubt that you can ask a question with words, but it is a lot more difficult to ask a question with just hand signals, non-verbal vocalizations, head movements, and anything else besides words. The same goes for changing the topic of the conversation; without words, the other people in the conversation might get confused and think that you are still referring to the last topic. Although, this could be resolved with a simple yes or no question that would be answered non-verbally. There were times that I was slightly excluded from the conversation, especially when they were conversing among themselves to determine the meaning of what I was saying. But, this was not long-lasting as they would then turn back to me and ask questions that I would then try to answer.

   If I was to imagine myself in this exercise as a representation of a culture that does not use a spoken language, and my girlfriend and her mother as a representation of a culture that does, I would with 100% certainty say that they (the spoken language using culture) would have a definite advantage over me (the non spoken language culture) in communicating complex ideas within our populations. Just as I said in the previous paragraph, the two most difficult aspects of the conversation were asking questions and changing topics. My girlfriend and her mother had the advantage in preforming these actions because they were able to use words to communicate. Without the use of a spoken language, communicating complex ideas is very difficult. There is a chance that things would be misinterpreted during the communication process due to the difficulty of asking clarifying questions if words are not able to be used. This concept would lead one to think that if these two cultures met, the one that was able to use words would see itself as far superior to the culture that did not use any form of spoken language to communicate. In a way, I think that my girlfriend and her mother demonstrated this excellently. During and after the experiment, they (jokingly) called me a "caveman". Even though they did not mean this seriously, it shows that the lack of the use of spoken language is associated with low levels of mental capabilities. To put it plainly, the culture that is able to use words to communicate would see the culture that does not use words to communicate as dumb, and on a much lesser intellectual level. One modern day example of this happening is the attitudes we have towards immigrants in the United States. Let's say a family of people from Africa just came to America, and they do not know enough of the English language to communicate with others. This could prove to be a big issue for the family, as in the past we have seen many instances where immigrants have been ridiculed for not knowing the English language when they are in America. It is quite unfortunate that this is true of the United States, but it is all too common that you hear the saying, "this is America, we speak English here." The lack of the ability to communicate through spoken language can even prove to turn hostile, where in some cases those who can use spoken language verbally or even physically attack those who cant.

   For the second part of this assignment, we were asked to have a conversation with others by only using our voices and no other forms of communication. The people that I chose to interact with were the same as in the first part of the assignment, my girlfriend and her mother. During this conversation, myself and the others found it to be significantly more difficult to communicate than in the first part where I could not use words. For me, the most difficult part of communicating was not being able to express emotion, or use any form of body language. This lack of emotional expression through tone, facial expressions or body language also made it difficult for them to understand the meaning of my words, and it forced them to ask a lot of yes or no questions. This was especially true when we talked about things that had to do with emotion, and other subjects that you could not just understand by taking the words I was saying at face value. Emotion being projected through expressions other than my monotone voice was needed in some cases to communicate and this made it difficult on both sides.

   After coming to the conclusion that communication is very difficult without the use of emotion, body language and other "signs" that give away our feelings, it is clear that through our use of spoken language to communicate that we rely heavily on these things. Without them, as myself, my girlfriend and her mother witnessed, communication would be very difficult and almost impossible. By reading another person's body language, a lot of different things can be observed. By examining someones facial expressions as they speak, looking at their posture or body position in relation to who they are talking to, and even observing the excess or lack of movements of their hands, feet, and eyes, you can pretty much tell exactly how a person is feeling. Also, when in combination with the words they are saying, the observations you make about someones non-verbal expressions can help you to understand the meaning of the words they are saying to a greater extent. In addition to this, the tone of their voice and the level of volume at which they are speaking are also very important factors that help to communicate meaning in a conversation.

  The adaptive benefit of being able to understand body language is such that those who are capable of doing so have a significant advantage over those who can not. This advantage, in humans,  is displayed in a multitude of different ways. For example, the ability to read body language is important in increasing our chances of survival during a situation where danger is present but not immediately obvious. It is possible that during a life-threatening situation, someone may be trying to communicate the danger of the situation through non-verbal forms of communication while keeping the danger hidden through their spoken language. This situation could possibly happen during a convenience store robbery, where the cash register attendant is being held at gunpoint by someone under the counter, out of sight of someone buying an item from the store. If the cash register attendant can communicate the danger to the customer through non-verbal forms of communication, they may be able to alert the authorities, or at least get the customer out of the dangerous situation. Another example of the adaptive benefit to being able to understand body language may be obtaining cash resources during a poker game, where being able to read body language can mean the difference between winning and losing. This benefit is also important while attracting mates, where the ability to read body language can help you to know if someone is interested in you or not.

   One example of someone who would have difficulty in reading body language is someone with the condition of autism. Individuals that are on the autistic spectrum may have a significant difficulty in reading other's non-verbal communication. And, although people that are blind can still understand changes in the tone and volume of someone's voice, they would be another example of someone who can not understand body language. One example of a situation where it would help to not be able to read someone's body language and non-verbal communication would be if you were traveling to another country for the first time; specifically one that is very foreign to your own culture. Not all cultures and places around the world express the same body language and non-verbal communication, and it may help you to communicate if you did not understand how to read theirs. It is possible that in their country, eye rolling could mean something completely different than it means in the United States, and this would throw you off significantly in the process of communicating.

Piltdown Man Hoax

   In the year 1912, an amateur archaeologist named Charles Dawson came across a fragment of a very old, human-like skull in Piltdown; which is a small town in East Sussex, England. Realizing the importance of such a discovery, Dawson contacted Arthur Smith Woodward, who was the keeper of archaeology at the Natural History Museum. Together, they claimed to have found a jawbone which resembled that of an ape, more skull fragments, and a set of teeth all belonging to the same individual. Smith Woodward then reconstructed the skull fragments, and announced at a Geological Society meeting that the fragments belonged to an ancient human ancestor - a find that was both astonishing and the first of its kind. For the next 45 years, the two men were known as the discoverers of the evidence that proved there was a common lineage between modern-day humans and apes. However, this label did not come without much controversy, and was the subject of serious debate within the scientific community and world. The debate over the find continued on until the year 1953, when evidence surfaced that shed light on what the find really was, a hoax. The fragments of skull that Dawson and Smith Woodward claimed to have unearthed from the site in Piltdown were found to have consisted of the altered jaw of an orangutan with teeth filed to appear like that of a human, intentionally combined with the cranium of a small brained, modern human. To everyone that had been the subject of the hoax's trickery in the scientific community, it was a genuine shock. However, it lead science in the right direction after the hoax was uncovered. Objectivity became the new safeguard for keeping things like this from happening in the future.

   Curiosity, creativity and persistence are all important parts of science. They each drive us toward discovery, new ways of looking at the universe, and new possibilities to explain the many unknowns we face in every day life. However, all three of these things are also traits that humans possess that make us what we are; human. As we all know, we are very complex creatures. One of the things that makes us this way is our capability to feel emotion. Often times, this emotion that we feel gets in the way of being truthful and clouds our judgement; both leaving us susceptible to dishonesty and a lack of objective thought. To me, it seems as if emotion was the true culprit of the hoax. Although it is unclear on whether Smith Woodward knew of the dishonest finds or not, its obvious that Dawson let his emotions take over his ability to be truthful. And just as it did for Dawson, the scientific community and the rest of the world (especially England) also fell under the spell of emotion. The significance of the find being in England made it very easy for Dawson to preform the hoax, and for the rest of England not to question it from an objective point of view. The scientific process fails when emotion is allowed to be the driving force.

   Now, being that the Piltdown hoax was in fact found out to be a hoax, there were some positive parts to the scientific process that came out of the 45-year long lie. After World War II, a new technology came about that allowed scientists to roughly date the age of fossils by observing the Fluorine content in them, which is absorbed from groundwater in the soil over time. After doing this test on the Piltdown Man's skull, it was found that the bones themselves were of different time periods, and from much more recent dates than Dawson and Woodward had lead the scientific community and world to believe. The evidence itself was incredibly startling, so a formal investigation in to the bones and men involved was launched. Some of the other signs that the Piltdown Man was in fact a hoax came out through close observation during the investigation. When the bone was being drilled to collect a fine dust to be tested, the bone gave off a smell that signified its young age. A bone of the age that the men had said it would be would not have given off such a smell. Also, when examining the teeth, it was found that they had been filed down with a steel tool because of the deep gashes that it left where the file had touched. The last test that was used to solidify the hoax was a Hydrochloric acid test, where the chemical compound was used to rub off the staining on the much younger-than-stated orangutan jaw. Finally, after 45 years, the scientific process was implemented correctly in order to verify the truthfulness (in this case, untruthfulness) of the find.

   Of course, it would be great if science could be free from things like human emotion, human error, and untruthfulness. But, unfortunately that's all we've got. There is no way that we could have scientists who are completely void of all of the imperfections that humans possess; or, is there? The answer is yes, there is a way. And I think we already have been implementing it for some time now. Computers are perfect; they don't make mistakes, they do exactly what they are programmed to do, and they do not let emotion or pride get in the way of looking at data objectively. And, without getting too much into the realm of an Orwellian dystopia where computers rule the world, I don't think it is too bad of an idea to keep moving forward in the direction of letting computers do most of the analyzing of data. Now, that's not to say that humans don't have a place in science. I refuse to believe that you can program the spark of human curiosity and wonder into a computer. But, if we are going to keep searching for advancements in anthropological study, or any form of scientific study, we need to keep objectivity at the core of the research. Hoaxes like the Piltdown Man won't happen again if we don't let them. The scientific method and all its beautiful processes are the strongest safeguard we have against events like this.

   On a final note, I think the best lesson that we as students, the scientific community, and the world can take from this event is the importance of critical thinking. One of the best things to happen to humankind was the scientific method. And as I said, objectivity has to be at the core of it. This is where critical thinking comes into play. If somebody told you that they were 100% certain that someone snapped their fingers and then all life was just created, you could objectively look at the claim the person is making and see their lack of evidence as an obvious sign of misinformation. On the same note, if someone told you that all life was gradually developed over the long history of the earth's existence through the process of evolution, you could objectively look at the plethora of evidence they have to defend their claim as a sign of strength to the argument. Critical thinking has a funny way of cutting through the mistakes that are created by not using scientific processes. Or, in the case of the Piltdown Man, un-scientific hoaxes.

http://www.nature.com/scitable/blog/simply-science/episode_10_missing_link_misunderstood 

https://www.youtube.com/watch?v=dOn97lU21L4

http://scienceblogs.com/evolvingthoughts/2009/05/11/there-is-no-missing-link/

https://www.youtube.com/watch?v=FUaJeNSkbC0

https://www.youtube.com/watch?v=lOxHLWMiULU
 

Analogy/Homology

1. 

a. The two species that I identified as having a homologous trait were humans and Felis Catus (common house cat). The domestic cat is a small, typically furry, carnivorous mammal. Humans are also mammals that are characterized by erect posture, movement on two feet, manual dexterity, increased tool usage compared to other mammals and a general trend towards larger, more complex brains and societies.  

b. The homologous trait that they share is between the tailbone in humans and the tail of the cat. In humans, the tailbone has become a vestigial structure. The coccyx, also known as the tailbone, is a "small, triangular bone resembling a shortened tail located at the bottom of the spine. It is composed of three to five coccygeal vertebrae or spinal bones. The vertebrae may be fused together to form a single bone; however, in some cases, the first vertebra is separate from the others" (Healthline). The tailbone functions as "an attachment site for tendons, ligaments, and muscles. It also functions as an insertion point of some of the muscles of the pelvic floor. The coccyx also functions to support and stabilize a person while he or she is in a sitting position" (Healthline). In domestic cats, the tail plays a much different role. The purpose of their tails is primarily for balance, marking their territory, and communication (Factual facts). The cat’s tail has "19 to 23 vertebrae, about 10 percent of the total number of bones in her body. An extensive group of muscles, ligaments, and tendons hold the tail together and provide its amazing mobility" (Catster). These homologous traits that the human and Felis Catus possess because of how each of the two species use them. The domestic cat uses its tail for a variety of reasons, many of which are for balance and communication, and the human only uses its tailbone for stabilization when in certain positions and support for the pelvic floor.

c. The common ancestor of humans and domestic cats is the first mammal to exist. All mammals possess this same homologous trait for a tail. Humans express this trait as a vestigial one as it is not used as a traditional tail like a domestic cat would.

d.

2.

a. The two species that I identified as having an analogous trait were dolphins and sharks. Dolphins are "highly intelligent marine mammals...(that are)...found worldwide, mostly in shallow seas of the continental shelves, and are carnivores, mostly eating fish and squid" (Defenders). Sharks belong to a family of fish that have skeletons made of cartilage, breathe through a series of five to seven gill slits located on either side of their bodies and have multiple rows of teeth. (Defenders).

b. The analogous trait that the dolphin and shark share is their dorsal fins. In dolphins, the dorsal fin, located on the top of the animal, is "filled with a fibrous  connective tissue. It serves to keep the animal upright and prevents "roll". Also, it has a thermo-regulation (body temperature adjustment) function" (Understand dolphins). Shark's dorsal fins do much of the same things for the animal. The only difference is that sharks have a pair of dorsal fins instead of just one. The first dorsal fin is "located on the top of a shark’s back and is used to stabilize the shark in the water. Lined with strong, flexible dorsal fibers, the first dorsal fin keeps a shark from rolling on it’s back and helps it make sharp turns while swimming fast" (Shark insider). The secondary dorsal fin "helps to stabilize the shark in the water. The second dorsal fin helps the shark swim steadily and maneuver the back of it’s body more easily" (Shark insider).

c. If you go far enough back in time, you will find a common ancestor of the shark and the dolphin. But, sharks are classified as fish and dolphins are classified as mammals. So, even though they both possess the same trait of having a dorsal fin that provides very similar functions for them, it is still an analogous trait. This is because it is not a result of common genetic history. It is, however, a result of common environmental pressure that caused both species to develop a similar adaptation to that stress.

d.

http://www.healthline.com/human-body-maps/coccyx

https://factualfacts.com/animals/cats-tails/

http://www.catster.com/lifestyle/cat-tail-5-cool-facts

http://www.defenders.org/dolphin/basic-facts

http://www.defenders.org/sharks/basic-facts

http://understanddolphins.tripod.com/dolphinfinstructurefunction.html

http://www.sharksider.com/understanding-shark-fins/

DNA code

ACATTACAAAACCGTTCAAGTGAGCACCCGTTGATGGATCGTAC

Thomas Malthus: The individual who's work and contributions most influenced Darwin's theory of natural selection

In the time period that Charles Darwin was completing the research that was necessary to support his theory of natural selection, the concept of species evolving to be better adapted for their environment was not a new concept. Several people, books, ideas and data that were available at the time strongly shaped his work, leading him to the conclusion that the origin of species existence and continued survival was directly related to the product of competition and natural selection.

After researching the many people who influenced Charles Darwin's life, work, and way of thinking, I now see that the most influential of the group was Thomas Malthus. In his book titled "An Essay on the Principle of Population," Malthus argued that "human populations grow faster than the resources that they depend on" (CK-12). Malthus recognized this as a problem because with the population of humans growing exponentially, and the amount of resources that humans need being produced only arithmetically, humans would soon run out of them completely, and perish as a result (CGGE). Malthusian economics laid the groundwork for Darwin's theory of natural selection. Limited resources force competition within a species and only those most fitted for survival would prosper.

From the bullet points listed under "How does evolution work," Malthus' work directly affected all of the first five. The first one, that highlights the Malthusian idea of exponential reproduction of humans, was indeed the starting point of Darwin's work as the bullet point information points out. The next two on the list, each having to do with the limitation of resources aim to answer the question posed at the bottom of the first bullet point; why is it that if species can reproduce exponentially, we are not witnessing them becoming dangerously overpopulated as Malthus predicted in humans? Darwin took the Malthusian idea that species reproduced exponentially and built on it to conclude that even though resources were limited, this limitation caused competition within the species and in turn created natural selection as an avenue to population control. In the next two bullet points which have to do with the idea that only the fittest will survive, it becomes extremely apparent that Darwin built off of Malthus' ideas. Organisms with better access to resources will be more likely to survive, and the ones that have the better access are able to do so because they are the most fit for survival. Using the Malthusian idea that if species could reproduce exponentially, Darwin reasoned that the only way the resources would not run out is if there was some sort of population control; natural selection caused only the fittest organisms to have access to the resources. Darwin's ideas did not contradict Malthus'. His ideas built on them and took them farther than Malthus ever did.

When examining the effects of Malthus' ideas on Darwin and trying to answer the question of if Darwin would have been able to come up with his theory of natural selection without him requires a few different things to be considered. The first of these is the fact that Malthus' book, "An Essay on the Principle of Population," inspired him and sparked his interest (All About...). Without Malthus' groundwork, Darwin possibly could have made a connection between the scarcity of resources and natural selection in species, but it is also possible that he couldn't. Another important thing to consider is that the ideas Darwin was proposing were both revolutionary and controversial in the eyes of the church and common man. Going against a theistic explanation for the natural occurrences he was witnessing and instead turning to science and observation of fact would have been seen as wrong. Without the groundwork that Malthus laid for Darwin, it is possible that he would have been discouraged from pursuing the idea any farther.

After Darwin published "On the Origin of Species," he received a great deal of backlash from various different directions. One of the most influential of these on him, both before he published his work and after, was the church. Before he published it, he "fully understood, and at times agonized over, the threat that his work might pose to traditional religious belief " (Masci). Darwin's theory on natural selection was no doubt in direct opposition to the views of the church, but he could see the writing on the wall in the form of observations that he had made in the real world. The attitude of the church made Darwin hesitant to publish his theory, however, he could see that the theistic explanation for the natural occurrences he was witnessing was not correct.

- Steven Moentmann 

http://www.ck12.org/book/CK-12-Biology-Concepts/section/5.13/

http://cgge.aag.org/PopulationandNaturalResources1e/CF_PopNatRes_Jan10/CF_PopNatRes_Jan108.html

http://www.allaboutscience.org/thomas-malthus-faq.htm

http://www.pewforum.org/2009/02/04/darwin-and-his-theory-of-evolution/